SGN Marker TG9

SGN-M82

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
800
Vector
pUC
Cutting Site
EcoR1/HindIII
Drug Resistance
AMP
Image
Forward sequence
GTAGTGATTCAATGTTGTGCAATATTAACATATTAACCTTGTTGCATAGAAAAAGTCTATGTAATCTGGTCTTATGCTACAATGAGGGAA
TGGGTTATTGTCTCCTAATGTGGTGGTAGAGAAGCCTCATCTAGTGAAAGAGCACTCAGATTTAGTAAAGTACATGGTCTAATAGCCATC
TACCTAGTTGTGTTTTCCAGTGTTGGCCCCAATGTTCTGTTATACACACTCTAGAAATTTTGGCGTGTGGGGAAGGTATTAGCATCAAAT
ATTGGACCAGGGAATGGGTTATTGTCTTCTTAAATGATCTTGAGACATTCTTTACATCATGAGCTAATTTTTTCCTTCTGGGGGTTGAGT
TATGACATATCCATTCTCCCTTACAAGTCATGCATCTTAAAATGCAGGTGAAAATCAAATTGACACACCTTTAGTTAAACCAACCAATAA
TCATGTAGATCAAGTAGTGTTTTTGTTATCAGGTAAATTAGAGGTTTCAATAGA
Reverse sequence
AAACAGTGCCTAGACTCTGGGATTTATTTTACTGTATTATATGGTGCCAAATGTCTACCTGTACTCATGAGATCTGTACTAAAACTTTAG
AACTCCATGATTTAAGAATGTTCAATTAGATCTCTTTATGCAATGGTGTGGATTATGTGCTTAAAAACAACTTAATCTATTGAAACCTCT
AATTTACCTGATAACAAAAACACTACTTGATCTACATGATTATTGGTTGGTTTAACTAAAGGTGTGTCAATTTGATTTTCACCTGCATTT
TAAGATGCATGACTTGTAAGGGAGAATGGATATGTCATAACTCAACCCCCAGAAGGAAAAAATTAGCTCATGATGTAAAGAATGTCTCAA
GATCATTTAAGAAGACAATAACCCATTCCCTGGTCCAATATTTGATGCTAATACCTTCCCCACACGCCAAAATTTCTAGAGTGTGTATAA
CAGAACATTGGGGCCAACACTGGAAAACACAACTAGGTAG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53383)
Chromosome
9
Position
48.53 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_9
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50422)
Chromosome
9
Position
1.91 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48354)
Chromosome
9
Position
24.35 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42504)
Chromosome
9
Position
9.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40131)
Chromosome
9
Position
23.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8001)
Chromosome
9
Position
21.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 8003)
Chromosome
9
Position
11.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8002)
Chromosome
9
Position
18.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8007)
Chromosome
9
Position
7.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG9 was used as an overgo probe on plate 14 [well G7]

Plausible BAC Matches:   P033F06,   P203J14,   P031F24,   P122P22,   P076M02,   P260J17,   P136D21

 Overgo Sequences

A sequence
GGGTTATTGTCTCCTAATGTGGTG
B sequence
GATGAGGCTTCTCTACCACCACAT
AB sequence
GGGTTATTGTCTCCTAATGTGGTGGTAGAG
Marker sequence
GTAGTGATTCAATGTTGTGCAATATTAACATATTAACCTTGTTGCATAGA
AAAAGTCTATGTAATCTGGTCTTATGCTACAATGAGGGAATGGGTTATTG
TCTCCTAATGTGGTGGTAGAGAAGCCTCATCTAGTGAAAGAGCACTCAGA
TTTAGTAAAGTACATGGTCTAATAGCCATCTACCTAGTTGTGTTTTCCAG
TGTTGGCCCCAATGTTCTGTTATACACACTCTAGAAATTTTGGCGTGTGG
GGAAGGTATTAGCATCAAATATTGGACCAGGGAATGGGTTATTGTCTTCT
TAAATGATCTTGAGACATTCTTTACATCATGAGCTAATTTTTTCCTTCTG
GGGGTTGAGTTATGACATATCCATTCTCCCTTACAAGTCATGCATCTTAA
AATGCAGGTGAAAATCAAATTGACACACCTTTAGTTAAACCAACCAATAA
TCATGTAGATCAAGTAGTGTTTTTGTTATCAGGTAAATTAGAGGTTTCAA
TAGA
Genomic location of TG9  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D82 marker 82
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)