SGN Marker C2_At4g11120

SGN-M8218
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300984 (SGN)
121276 (CGN)
---
Lycopersicon CombinedSingleSGN-U216276---
Solanum tuberosumMultipleSGN-U244516---
ArabidopsisSingleAt4g11120 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49270)
Chromosome
12
Position
4.13 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47208)
Chromosome
12
Position
52.40 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46714)
Chromosome
6
Position
17.20 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46503)
Chromosome
6
Position
15.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Eggplant-COSII   
Map version
63 (location: 42237)
Chromosome
10
Position
48.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43804
Forward primer (5'-3')
TGGAGTTAGTGGCTAGGCTGGA
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
TGAAGTCCTTCGCCAACTTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41468)
Chromosome
9
Position
142.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43444
Forward primer (5'-3')
AACGCGAGATTCTCAAATCTCAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGCGCAAACGACCTTCAACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38629)
Chromosome
12
Position
48.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39815
Forward primer (5'-3')
AACGCGAGATTCTCAAATCTCAG
Accessions and product sizes
Solanum pennellii TA56
2100
Solanum lycopersicum TA209
2000
Approximate temperature
53°C
Reverse primer (5'-3')
TGCGCAAACGACCTTCAACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26659)
Chromosome
4
Position
6.78 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11386
Forward primer (5'-3')
AACGCGAGATTCTCAAATCTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCGCAAACGACCTTCAACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 11387
Forward primer (5'-3')
AACGCGAGATTCTCAAATCTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCGCAAACGACCTTCAACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 11388
Forward primer (5'-3')
AACGCGAGATTCTCAAATCTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCGCAAACGACCTTCAACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 550
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At4g11120F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At4g11120  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8218 marker 8218
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)