SGN Marker C2_At4g11560

SGN-M8221
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308300 (SGN)
129158 (CGN)
---
Solanum tuberosumSingleSGN-U250673---
ArabidopsisSingleAt4g11560 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109241)
Chromosome
8
Position
26.64 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38630)
Chromosome
8
Position
72.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39816
Forward primer (5'-3')
TTCCAGAAGGACAACTTCAGAAGCC
Accessions and product sizes
Solanum pennellii TA56
450
Solanum lycopersicum TA209
425
Approximate temperature
53°C
Reverse primer (5'-3')
TGTTTAATGGTATGAAGTGCACCACAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
450
Solanum lycopersicum TA209
425
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26662)
Chromosome
4
Position
7.00 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32444
Forward primer (5'-3')
TTCCAGAAGGACAACTTCAGAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTTAATGGTATGAAGTGCACCACAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 32445
Forward primer (5'-3')
TTCCAGAAGGACAACTTCAGAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTTAATGGTATGAAGTGCACCACAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 32446
Forward primer (5'-3')
TTCCAGAAGGACAACTTCAGAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTTAATGGTATGAAGTGCACCACAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 32447
Forward primer (5'-3')
TTCCAGAAGGACAACTTCAGAAGCC
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 250+400+550
Solanum pennellii LA716: 200+375+550
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTTTAATGGTATGAAGTGCACCACAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1400
Solanum pennellii LA716: 1400
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At4g11560  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8221 marker 8221
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)