SGN Marker C2_At4g12230

SGN-M8227
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U204269---
Lycopersicon CombinedSingleSGN-U225001---
Solanum tuberosumMultipleSGN-U250460---
ArabidopsisSingleAt4g12230 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41469)
Chromosome
1
Position
40.70 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43445
Forward primer (5'-3')
AAGTGATCTAATATCTTTTTGTATATATAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38633)
Chromosome
8
Position
63.80 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39819
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
Accessions and product sizes
Solanum pennellii TA56
350
Solanum lycopersicum TA209
350
Approximate temperature
55°C
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
100+150
Solanum pennellii TA56
80+100
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26668)
Chromosome
4
Position
7.29 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11397
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 11398
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 11399
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13389
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13390
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13391
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13392
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13393
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13394
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13395
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13396
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13397
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13398
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13399
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13400
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 33086
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 33087
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 33088
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 33089
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 11400
Forward primer (5'-3')
TCTCAGCTTCAATGCCATGGGCTC
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 150+100
Solanum pennellii LA716: 100+80
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCACTTAGCACATGCCGTTTCAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At4g12230  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8227 marker 8227
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)