SGN Marker C2_At4g14930

SGN-M8248
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U198097---
Lycopersicon CombinedSingleSGN-U220346---
Solanum tuberosumMultipleSGN-U245734---
ArabidopsisSingleAt4g14930 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26689)
Chromosome
4
Position
8.54 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41559
Forward primer (5'-3')
AGCAAGGATGATGATTTCGTATTGGC
Accessions and product sizes
Solanum pennellii TA56
275
Solanum lycopersicum TA209
275
Approximate temperature
55°C
Reverse primer (5'-3')
TTGCCTTGCTTCGTCAGACGATAACC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
250
Solanum lycopersicum TA209
300
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g14930  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8248 marker 8248
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)