SGN Marker C2_At4g15790

SGN-M8257
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303900 (SGN)
120630 (CGN)
---
Lycopersicon CombinedSingleSGN-U223486---
ArabidopsisSingleAt4g15790 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38643)
Chromosome
1
Position
33.30 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39827
Forward primer (5'-3')
ATTGACTGAGTCAAGGCAAGAGCTGC
Accessions and product sizes
Solanum lycopersicum TA209
425
Solanum pennellii TA56
450
Approximate temperature
55°C
Reverse primer (5'-3')
TAAGTTTCTTAAGCTGTTGGTAACATC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
425
Solanum pennellii TA56
450
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26698)
Chromosome
4
Position
8.98 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32456
Forward primer (5'-3')
ATTGACTGAGTCAAGGCAAGAGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAGTTTCTTAAGCTGTTGGTAACATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1600
Approximate temperature
55°C
  
PCR data   Exp. ID 32457
Forward primer (5'-3')
ATTGACTGAGTCAAGGCAAGAGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAGTTTCTTAAGCTGTTGGTAACATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1600
Approximate temperature
55°C
  
PCR data   Exp. ID 32458
Forward primer (5'-3')
ATTGACTGAGTCAAGGCAAGAGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAGTTTCTTAAGCTGTTGGTAACATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1600
Approximate temperature
55°C
  
PCR data   Exp. ID 32459
Forward primer (5'-3')
ATTGACTGAGTCAAGGCAAGAGCTGC
Digested band sizes (using HincII)
Solanum pennellii LA716: 1400
Solanum lycopersicum LA925: 550+1050
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAGTTTCTTAAGCTGTTGGTAACATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1600
Solanum pennellii LA716: 1600
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At4g15790  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8257 marker 8257
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)