SGN Marker C2_At4g16580

SGN-M8274
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302399 (SGN)
121688 (CGN)
---
Lycopersicon CombinedMultipleSGN-U223010---
Solanum tuberosumSingleSGN-U250937---
ArabidopsisSingleAt4g16580 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49271)
Chromosome
12
Position
62.66 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47210)
Chromosome
12
Position
81.12 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46718)
Chromosome
12
Position
39.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41472)
Chromosome
12
Position
83.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43448
Forward primer (5'-3')
TGTTACCTGCCTCATCCTGATAAAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATTTTGAAGACCTCTCCAGAACTTGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38647)
Chromosome
12
Position
85.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39829
Forward primer (5'-3')
TGTTACCTGCCTCATCCTGATAAAG
Accessions and product sizes
Solanum pennellii TA56
Multiple
Approximate temperature
50°C
Reverse primer (5'-3')
ATTTTGAAGACCTCTCCAGAACTTGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26715)
Chromosome
4
Position
9.34 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32460
Forward primer (5'-3')
TGTTACCTGCCTCATCCTGATAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTTTGAAGACCTCTCCAGAACTTGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 32461
Forward primer (5'-3')
TGTTACCTGCCTCATCCTGATAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTTTGAAGACCTCTCCAGAACTTGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 32462
Forward primer (5'-3')
TGTTACCTGCCTCATCCTGATAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTTTGAAGACCTCTCCAGAACTTGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 32463
Forward primer (5'-3')
TGTTACCTGCCTCATCCTGATAAAG
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 150+200
Solanum pennellii LA716: 200+350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTTTGAAGACCTCTCCAGAACTTGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 550
Solanum lycopersicum LA925: 550
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At4g16580  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8274 marker 8274
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)