SGN Marker C2_At4g17070

SGN-M8279
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304704 (SGN)
123257 (CGN)
---
Capsicum annuumSingleSGN-U201936---
Lycopersicon CombinedSingleSGN-U225799---
Solanum tuberosumSingleSGN-U253172---
ArabidopsisSingleAt4g17070 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26720)
Chromosome
4
Position
9.60 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41571
Forward primer (5'-3')
AGTTGTTGAGGTTTCGACACTGTGC
Accessions and product sizes
Solanum lycopersicum TA209
1100
Solanum pennellii TA56
1100
Approximate temperature
55°C
Reverse primer (5'-3')
TCTGATTTCGTGGGGAGCTGAGC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
400+700
Solanum lycopersicum TA209
100+400+600
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g17070  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8279 marker 8279
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)