SGN Marker SSR155

SGN-M828

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: TAT   Repeat number: 9
Repeat motif:    Repeat number:
Forward primer: TACATGGTGCTCAAACTCGC
Reverse primer: TGGTTGAGAAGGACAGGTGA
Predicted size: 152
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39180)
Chromosome
9
Position
55.50 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 116
Forward primer (5'-3')
TACATGGTGCTCAAACTCGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGTTGAGAAGGACAGGTGA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 200+200
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
SSR155 was used as an overgo probe on plate 7 [well F6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTCAACAAGAACACACACCACCAT
B sequence
AGTGAGAAAGACAGCCATGGTGGT
AB sequence
GTCAACAAGAACACACACCACCATGGCTGT
Marker sequence
GCTCTCTTTGTCTCTTTGCAGCTAATAACATAACATGACTGCTCTTTATC
TTCATCTTTCTTTCTTTGTCAACAAGAACACACACCACCATGGCTGTCTT
TCTCACTAGCTAATATATTCCAGCTAGCTAGCTTAAATACATGGTGCTCA
AACTCGCACGAACACAAAAATAGCCACTAATATACCTATACCTAGCTATT
ATTATTATTATTATTATTATTATCATAATTAAGCACATACCAAGCAACAT
ACATGTAAAACCACACATTTCACCTGTCCTTCTCAACCAAAAAGCTATGT
TATCATCATTATATTAAAAATAAATAAAAAATCACATATCCTTCCCCACT
TTCTCTATGTGCTATCTTTGTATTCAAAATTTATATATTCAAGAGAATTA
TGAAGAGTCTCTCTCAAAAAAAG
Genomic location of SSR155  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D828 marker 828
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)