SGN Marker C2_At4g18230

SGN-M8288
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U204423---
Lycopersicon CombinedSingleSGN-U241678---
Solanum tuberosumSingleSGN-U255920---
ArabidopsisSingleAt4g18230 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49272)
Chromosome
3
Position
0.55 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47211)
Chromosome
3
Position
7.30 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42239)
Chromosome
3
Position
2.60 cM
Confidence
I
Protocol
PCR


Eggplant-COSII

PCR data   Exp. ID 43806
Forward primer (5'-3')
AATTGCACATGCGTTGTGGTTAATG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TAGAAAATCGATGACCACCTAATTCCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41476)
Chromosome
4
Position
0.00 cM
Confidence
I(LOD2)
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43452
Forward primer (5'-3')
TGGAACGTGTATTCCACTATGTGTAAT
Accessions and product sizes
Approximate temperature
65°C
Reverse primer (5'-3')
TTTCTATGTCGAGAGCATTGCAAGAGT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38653)
Chromosome
3
Position
7.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41573
Forward primer (5'-3')
AATTGCACATGCGTTGTGGTTAATG
Accessions and product sizes
Solanum pennellii TA56
700
Solanum lycopersicum TA209
700
Approximate temperature
55°C
Reverse primer (5'-3')
TAGAAAATCGATGACCACCTAATTCCC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
600
Solanum lycopersicum TA209
700
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26729)
Chromosome
4
Position
10.08 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g18230  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8288 marker 8288
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)