SGN Marker SSR156

SGN-M829

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: TCT   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: CACGCCTATGCACCTTTCTT
Reverse primer: CTTCAAGGCTAAACCTCCGA
Predicted size: 167
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39181)
Chromosome
1
Position
146.00 cM
Confidence
F(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 17
Forward primer (5'-3')
CACGCCTATGCACCTTTCTT
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CTTCAAGGCTAAACCTCCGA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 167+167
Solanum pennellii LA716: 150+167
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR156 was used as an overgo probe on plate 8 [well H2]

Plausible BAC Matches:   P101K17,   P108N21

 Overgo Sequences

A sequence
TTGTTCGGCGCAATCAACGACCAT
B sequence
TTGAACAAACGCTGGGATGGTCGT
AB sequence
TTGTTCGGCGCAATCAACGACCATCCCAGC
Marker sequence
CGTGCCCACAGCTCATTCCGCACGCACGCCTATGCACCTTTCTTAATGGA
TATTCTTACCCTCAATCCCACTTTCTTCCCTAAAATTCCTCTTCTTCTTC
TTCTTCTTCTGAGTAGAAAAAACAAGAACCGAAAGGACTAATGGATCCAT
GTCCGTTCGTCCGTATTGTAATCGGAGGTTTAGCCTTGAAGTTCCCTTCT
GAATCAAAAATACCACCCAATAGTTCAACTTTTGATTGTAAAATCAAGCT
TAGAGGTTGTTCGGCGCAATCAACGACCATCCCAGCGTTTGTTCAAGAAA
GAGAAGCGATCGTGGATAATAGAATTCATGGTTGTTTTAATTTTAGTAAG
TCAGAGCTTGTGAAATTCGTTGAGAAATCGAATGTTAGAGGAAAATCCAA
TTGTTTAAAGATTGAGATTTATGGGGGTAAAGTGGGTTTTGGGTATGGTA
GTAAGAGGCTTTTGGGGAGTGTTGTGGTGCCATTGGATTTGAAGAGTTTG
GAGAATATTGGACATAGAGGATTTGTGATTCAAAATGGATGGGTTTCTGT
TGGTGGTGGGTCTACTGCTCAATTGAA
Genomic location of SSR156  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D829 marker 829
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)