SGN Marker C2_At4g18593

SGN-M8293
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309574 (SGN)
127223 (CGN)
---
Capsicum annuumSingleSGN-U204489---
Lycopersicon CombinedMultipleSGN-U234856---
Solanum tuberosumSingleSGN-U252040---
ArabidopsisSingleAt4g18593 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49273)
Chromosome
12
Position
14.65 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47212)
Chromosome
12
Position
61.05 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42240)
Chromosome
10
Position
60.20 cM
Confidence
I
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43807
Forward primer (5'-3')
AGGTGATTGTTATAATCGTGGAGAAAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GCACTCTTTAGCAAACTTTGGTCGA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41477)
Chromosome
3
Position
59.30 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43453
Forward primer (5'-3')
AGGTGATTGTTATAATCGTGGAGAAAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTCACAATGCGCACATAAAAGCTTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38655)
Chromosome
12
Position
59.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39834
Forward primer (5'-3')
AGGTGATTGTTATAATCGTGGAGAAAG
Accessions and product sizes
Solanum pennellii TA56
Multiple
Approximate temperature
50°C
Reverse primer (5'-3')
TTCACAATGCGCACATAAAAGCTTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26734)
Chromosome
4
Position
10.24 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32472
Forward primer (5'-3')
AGGTGATTGTTATAATCGTGGAGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCACAATGCGCACATAAAAGCTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 32473
Forward primer (5'-3')
AGGTGATTGTTATAATCGTGGAGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCACAATGCGCACATAAAAGCTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 32474
Forward primer (5'-3')
AGGTGATTGTTATAATCGTGGAGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCACAATGCGCACATAAAAGCTTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 32475
Forward primer (5'-3')
AGGTGATTGTTATAATCGTGGAGAAAG
Digested band sizes (using HaeIII)
Solanum pennellii LA716: 850
Solanum lycopersicum LA925: 700+150
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCACAATGCGCACATAAAAGCTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At4g18593  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8293 marker 8293
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)