SGN Marker C2_At4g21520

SGN-M8316
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300677 (SGN)
122353 (CGN)
---
Capsicum annuumSingleSGN-U199746---
Lycopersicon CombinedSingleSGN-U228577---
Solanum tuberosumSingleSGN-U267886---
ArabidopsisSingleAt4g21520 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38662)
Chromosome
2
Position
69.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39840
Forward primer (5'-3')
TGACGGGGAGTCTGTATATGACTATTG
Accessions and product sizes
Solanum pennellii TA56
2000
Solanum lycopersicum TA209
2000
Approximate temperature
55°C
Reverse primer (5'-3')
TGATTGCCCTTCTTTATTTCCTTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
1700
Solanum pennellii TA56
1700
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26756)
Chromosome
4
Position
11.45 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11444
Forward primer (5'-3')
TGACGGGGAGTCTGTATATGACTATTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTGCCCTTCTTTATTTCCTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 11445
Forward primer (5'-3')
TGACGGGGAGTCTGTATATGACTATTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTGCCCTTCTTTATTTCCTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 11446
Forward primer (5'-3')
TGACGGGGAGTCTGTATATGACTATTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTGCCCTTCTTTATTTCCTTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32480
Forward primer (5'-3')
TGACGGGGAGTCTGTATATGACTATTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTGCCCTTCTTTATTTCCTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Approximate temperature
53°C
  
PCR data   Exp. ID 32481
Forward primer (5'-3')
TGACGGGGAGTCTGTATATGACTATTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTGCCCTTCTTTATTTCCTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Approximate temperature
53°C
  
PCR data   Exp. ID 32482
Forward primer (5'-3')
TGACGGGGAGTCTGTATATGACTATTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTGCCCTTCTTTATTTCCTTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1000
Approximate temperature
53°C
  
PCR data   Exp. ID 32483
Forward primer (5'-3')
TGACGGGGAGTCTGTATATGACTATTG
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 350+650
Solanum pennellii LA716: 1000
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTGCCCTTCTTTATTTCCTTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: BslI,DraI,EcoNI,HaeIII,StuI,TaqI,Tsp509I,XmnI
All possible enzymes for lycopersicum and pimpinellifolium: ScrFI,SsPI
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 1000
Approximate temperature
53°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At4g21520F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At4g21520  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8316 marker 8316
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)