SGN Marker C2_At4g21580

SGN-M8318
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302527 (SGN)
123187 (CGN)
---
Lycopersicon CombinedMultipleSGN-U219640---
Solanum tuberosumSingleSGN-U262303---
ArabidopsisSingleAt4g21580 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38664)
Chromosome
2
Position
68.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39842
Forward primer (5'-3')
TCGCTGGAAAATTGGTGATCAG
Accessions and product sizes
Solanum pennellii TA56
1350
Solanum lycopersicum TA209
1350
Approximate temperature
55°C
Reverse primer (5'-3')
ATGAAAATGGTCGACCAAACAGTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1350
Solanum lycopersicum TA209
570+750
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26758)
Chromosome
4
Position
11.48 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11450
Forward primer (5'-3')
TCGCTGGAAAATTGGTGATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGAAAATGGTCGACCAAACAGTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 11451
Forward primer (5'-3')
TCGCTGGAAAATTGGTGATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGAAAATGGTCGACCAAACAGTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 11452
Forward primer (5'-3')
TCGCTGGAAAATTGGTGATCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGAAAATGGTCGACCAAACAGTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 11453
Forward primer (5'-3')
TCGCTGGAAAATTGGTGATCAG
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 570+750
Solanum pennellii LA716: 1350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGAAAATGGTCGACCAAACAGTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: HaeIII
  
Accessions and product sizes
Solanum lycopersicum LA925: 1350
Solanum pennellii LA716: 1350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At4g21580  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8318 marker 8318
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)