SGN Marker SSR159

SGN-M832

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: CAA   Repeat number: 9
Repeat motif: CTTC   Repeat number: 2
Repeat motif:    Repeat number:
Forward primer: ACAACAAAGGCAGCTGGTTC
Reverse primer: GCTTCCGACAGCCCATATAA
Predicted size: 212
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39182)
Chromosome
10
Position
46.00 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14145
Forward primer (5'-3')
ACAACAAAGGCAGCTGGTTC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GCTTCCGACAGCCCATATAA
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 192+212
Solanum lycopersicum LA925: 204+212
Approximate temperature
50°C
  
Genomic location of SSR159  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D832 marker 832
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)