SGN Marker C2_At4g21770

SGN-M8322
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310092 (SGN)
130720 (CGN)
---
Lycopersicon CombinedSingleSGN-U229818---
ArabidopsisSingleAt4g21770 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26762)
Chromosome
4
Position
11.56 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41582
Forward primer (5'-3')
TGTAAAGCTTTGGACCTCCCTCC
Accessions and product sizes
Solanum pennellii TA56
1500
Solanum lycopersicum TA209
1500
Approximate temperature
50°C
Reverse primer (5'-3')
AAGCGCTTAGGGTGTACATGCAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
550+650
Solanum pennellii TA56
650+800
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g21770  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8322 marker 8322
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)