SGN Marker C2_At4g24610

SGN-M8352
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Lycopersicon CombinedSingleSGN-U226949---
Solanum tuberosumSingleSGN-U248380---
ArabidopsisSingleAt4g24610 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26793)
Chromosome
4
Position
12.70 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11477
Forward primer (5'-3')
ATCGCAAGTTGTCGAGGCTACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGACCGGTTCTCTTTCCTGCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 100
Approximate temperature
55°C
  
PCR data   Exp. ID 11478
Forward primer (5'-3')
ATCGCAAGTTGTCGAGGCTACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGACCGGTTCTCTTTCCTGCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 100
Approximate temperature
55°C
  
PCR data   Exp. ID 11479
Forward primer (5'-3')
ATCGCAAGTTGTCGAGGCTACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGACCGGTTCTCTTTCCTGCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 100
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g24610  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8352 marker 8352
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)