SGN Marker C2_At4g24690

SGN-M8354
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300628 (SGN)
120170 (CGN)
---
Capsicum annuumSingleSGN-U197947---
Lycopersicon CombinedSingleSGN-U219136---
Solanum tuberosumMultipleSGN-U244336---
ArabidopsisSingleAt4g24690 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38672)
Chromosome
6
Position
62.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39849
Forward primer (5'-3')
TTGCCTTCAGGGGAGAAGTTTGG
Accessions and product sizes
Solanum lycopersicum TA209
150
Solanum pennellii TA56
150
Approximate temperature
53°C
Reverse primer (5'-3')
TCAACTAATTCCATGGCAGGGTTTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26795)
Chromosome
4
Position
12.74 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11483
Forward primer (5'-3')
TTGCCTTCAGGGGAGAAGTTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAACTAATTCCATGGCAGGGTTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Approximate temperature
53°C
  
PCR data   Exp. ID 11484
Forward primer (5'-3')
TTGCCTTCAGGGGAGAAGTTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAACTAATTCCATGGCAGGGTTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Approximate temperature
53°C
  
PCR data   Exp. ID 11485
Forward primer (5'-3')
TTGCCTTCAGGGGAGAAGTTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAACTAATTCCATGGCAGGGTTTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 350
Approximate temperature
53°C
  
PCR data   Exp. ID 13452
Forward primer (5'-3')
TTGCCTTCAGGGGAGAAGTTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAACTAATTCCATGGCAGGGTTTG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13453
Forward primer (5'-3')
TTGCCTTCAGGGGAGAAGTTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAACTAATTCCATGGCAGGGTTTG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13454
Forward primer (5'-3')
TTGCCTTCAGGGGAGAAGTTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAACTAATTCCATGGCAGGGTTTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13455
Forward primer (5'-3')
TTGCCTTCAGGGGAGAAGTTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAACTAATTCCATGGCAGGGTTTG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13456
Forward primer (5'-3')
TTGCCTTCAGGGGAGAAGTTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAACTAATTCCATGGCAGGGTTTG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13457
Forward primer (5'-3')
TTGCCTTCAGGGGAGAAGTTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAACTAATTCCATGGCAGGGTTTG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13458
Forward primer (5'-3')
TTGCCTTCAGGGGAGAAGTTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAACTAATTCCATGGCAGGGTTTG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32644
Forward primer (5'-3')
TTGCCTTCAGGGGAGAAGTTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAACTAATTCCATGGCAGGGTTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 33107
Forward primer (5'-3')
TTGCCTTCAGGGGAGAAGTTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAACTAATTCCATGGCAGGGTTTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 33108
Forward primer (5'-3')
TTGCCTTCAGGGGAGAAGTTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAACTAATTCCATGGCAGGGTTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 33109
Forward primer (5'-3')
TTGCCTTCAGGGGAGAAGTTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAACTAATTCCATGGCAGGGTTTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 11486
Forward primer (5'-3')
TTGCCTTCAGGGGAGAAGTTTGG
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 330
Solanum pennellii LA716: 350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAACTAATTCCATGGCAGGGTTTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, DraI, TaqI, EcoRv, HaeIII
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Solanum pennellii LA716: 350
Approximate temperature
53°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At4g24690  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8354 marker 8354
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)