SGN Marker C2_At4g24830

SGN-M8358
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302935 (SGN)
123764 (CGN)
---
Lycopersicon CombinedMultipleSGN-U214048---
Solanum tuberosumSingleSGN-U266353---
ArabidopsisSingleAt4g24830 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132190)
Chromosome
10
Position
67.49 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Eggplant-COSII   
Map version
63 (location: 42243)
Chromosome
10
Position
69.80 cM
Confidence
I
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43810
Forward primer (5'-3')
TGATGTTGCCAGAGAGGTTGGAGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCAGAGCAAAGAATGTCAGCTCAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38675)
Chromosome
5
Position
51.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39852
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
Accessions and product sizes
Solanum lycopersicum TA209
300
Solanum pennellii TA56
300
Approximate temperature
55°C
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
300
Solanum pennellii TA56
280
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26799)
Chromosome
4
Position
12.79 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11491
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 11492
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 11493
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 13459
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13460
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13461
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13462
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13463
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13464
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13465
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13466
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13467
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13468
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 500+850
Approximate temperature
55°C
  
PCR data   Exp. ID 13469
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 13470
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13471
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 33110
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 33111
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33112
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33113
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 11494
Forward primer (5'-3')
ATACTTGCTTGGGACATCAATGGC
Digested band sizes (using MspI)
Solanum lycopersicum LA925: 1250
Solanum pennellii LA716: 1350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAACCTCTCTGGCAACATCAACC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI,MspI,RsaI,DraI,TaqI,RV,HaeIII,DpnII,KpnI
All possible enzymes for lycopersicum and pimpinellifolium: MspI
  
Accessions and product sizes
Solanum pennellii LA716: 1350
Solanum lycopersicum LA925: 1350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At4g24830  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8358 marker 8358
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)