SGN Marker C2_At4g25650

SGN-M8365
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303819 (SGN)
121852 (CGN)
---
Lycopersicon CombinedSingleSGN-U220480---
ArabidopsisSingleAt4g25650 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49275)
Chromosome
4
Position
31.08 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47214)
Chromosome
4
Position
35.50 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. acuminata   
Map version
89 (location: 46507)
Chromosome
4
Position
15.50 cM
Confidence
I(LOD2)
Protocol
PCR


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41483)
Chromosome
5
Position
0.00 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43459
Forward primer (5'-3')
AGCGCAAGCTAAAGGAAATTGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AAGTCTGTACTGAACAATCTAGCAAGATA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38676)
Chromosome
4
Position
37.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39853
Forward primer (5'-3')
AGCGCAAGCTAAAGGAAATTGG
Accessions and product sizes
Solanum pennellii TA56
600
Solanum lycopersicum TA209
600
Approximate temperature
50°C
Reverse primer (5'-3')
TGCCCTGCTTTAAAGCAGCAAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
500
Solanum lycopersicum TA209
600
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26806)
Chromosome
4
Position
13.08 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32496
Forward primer (5'-3')
AGCGCAAGCTAAAGGAAATTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCCTGCTTTAAAGCAGCAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 32497
Forward primer (5'-3')
AGCGCAAGCTAAAGGAAATTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCCTGCTTTAAAGCAGCAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 32498
Forward primer (5'-3')
AGCGCAAGCTAAAGGAAATTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCCTGCTTTAAAGCAGCAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 32499
Forward primer (5'-3')
AGCGCAAGCTAAAGGAAATTGG
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 200+125
Solanum pennellii LA716: 250+125
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCCTGCTTTAAAGCAGCAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g25650  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8365 marker 8365
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)