SGN Marker C2_At4g26750

SGN-M8374
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302171 (SGN)
120413 (CGN)
---
Lycopersicon CombinedMultipleSGN-U222974---
Solanum tuberosumSingleSGN-U247884---
ArabidopsisSingleAt4g26750 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46726)
Chromosome
8
Position
12.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46509)
Chromosome
8
Position
6.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41485)
Chromosome
7
Position
110.40 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43461
Forward primer (5'-3')
AAGGATAACGAACCAGCAAAGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTTGAGGAATCCTCAATCCTCG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38679)
Chromosome
7
Position
80.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39856
Forward primer (5'-3')
AAGGATAACGAACCAGCAAAGC
Accessions and product sizes
Solanum lycopersicum TA209
1350
Solanum pennellii TA56
1350
Approximate temperature
55°C
Reverse primer (5'-3')
TTTGAGGAATCCTCAATCCTCG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1200
Solanum lycopersicum TA209
500+850
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26815)
Chromosome
4
Position
13.48 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11498
Forward primer (5'-3')
AAGGATAACGAACCAGCAAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTGAGGAATCCTCAATCCTCG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 11499
Forward primer (5'-3')
AAGGATAACGAACCAGCAAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTGAGGAATCCTCAATCCTCG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 11500
Forward primer (5'-3')
AAGGATAACGAACCAGCAAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTGAGGAATCCTCAATCCTCG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13472
Forward primer (5'-3')
AAGGATAACGAACCAGCAAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTGAGGAATCCTCAATCCTCG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13473
Forward primer (5'-3')
AAGGATAACGAACCAGCAAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTGAGGAATCCTCAATCCTCG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13474
Forward primer (5'-3')
AAGGATAACGAACCAGCAAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTGAGGAATCCTCAATCCTCG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13475
Forward primer (5'-3')
AAGGATAACGAACCAGCAAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTGAGGAATCCTCAATCCTCG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 13476
Forward primer (5'-3')
AAGGATAACGAACCAGCAAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTGAGGAATCCTCAATCCTCG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 33114
Forward primer (5'-3')
AAGGATAACGAACCAGCAAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTGAGGAATCCTCAATCCTCG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 11501
Forward primer (5'-3')
AAGGATAACGAACCAGCAAAGC
Digested band sizes (using RsaI)
Solanum pennellii LA716: 300
Solanum lycopersicum LA925: 400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTGAGGAATCCTCAATCCTCG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI,MspI,RsaI,DraI,TaqI,RV,HaeIII,HinfI,KpnI
  
Accessions and product sizes
Solanum pennellii LA716: 400
Solanum lycopersicum LA925: 400
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At4g26750  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8374 marker 8374
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)