SGN Marker C2_At4g26900

SGN-M8375
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307795 (SGN)
128047 (CGN)
---
Capsicum annuumSingleSGN-U198837---
Solanum tuberosumSingleSGN-U253810---
ArabidopsisSingleAt4g26900 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26816)
Chromosome
4
Position
13.52 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41598
Forward primer (5'-3')
TACTGCTAAACTGCATTGATTGTGATG
Accessions and product sizes
Solanum pennellii TA56
350
Solanum lycopersicum TA209
350
Approximate temperature
53°C
Reverse primer (5'-3')
AATCACAGGAATGCTTACAGCATCTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
350
Solanum lycopersicum TA209
330
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 11502
Forward primer (5'-3')
TACTGCTAAACTGCATTGATTGTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCACAGGAATGCTTACAGCATCTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 850
Approximate temperature
53°C
  
PCR data   Exp. ID 11503
Forward primer (5'-3')
TACTGCTAAACTGCATTGATTGTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCACAGGAATGCTTACAGCATCTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
53°C
  
PCR data   Exp. ID 11504
Forward primer (5'-3')
TACTGCTAAACTGCATTGATTGTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCACAGGAATGCTTACAGCATCTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 850
Approximate temperature
53°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At4g26900  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8375 marker 8375
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)