SGN Marker C2_At4g28990

SGN-M8397
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301576 (SGN)
124507 (CGN)
---
Capsicum annuumSingleSGN-U198074---
Lycopersicon CombinedSingleSGN-U231101---
ArabidopsisSingleAt4g28990 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26838)
Chromosome
4
Position
14.29 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41604
Forward primer (5'-3')
TACGGCCTACTGACAGCGGCG
Accessions and product sizes
Solanum pennellii TA56
700
Solanum lycopersicum TA209
700
Approximate temperature
55°C
Reverse primer (5'-3')
ACCATCTCTTGGCCGTACATTTGG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
175+300
Solanum lycopersicum TA209
150+475
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g28990  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8397 marker 8397
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)