SGN Marker C2_At4g31115

SGN-M8415
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306873 (SGN)
125479 (CGN)
---
Lycopersicon CombinedSingleSGN-U226190---
ArabidopsisSingleAt4g31115 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38692)
Chromosome
8
Position
36.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39868
Forward primer (5'-3')
ACTTCTAAATTTTGAAGTTGCCCCTG
Accessions and product sizes
Solanum pennellii TA56
550
Solanum lycopersicum TA209
550
Approximate temperature
53°C
Reverse primer (5'-3')
AGAAGTAGGCAGCATGGTGAATGG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
200+350
Solanum pennellii TA56
550
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26858)
Chromosome
4
Position
15.13 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32519
Forward primer (5'-3')
ACTTCTAAATTTTGAAGTTGCCCCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAAGTAGGCAGCATGGTGAATGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1800
Approximate temperature
60°C
  
PCR data   Exp. ID 32520
Forward primer (5'-3')
ACTTCTAAATTTTGAAGTTGCCCCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAAGTAGGCAGCATGGTGAATGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1800
Approximate temperature
60°C
  
PCR data   Exp. ID 32521
Forward primer (5'-3')
ACTTCTAAATTTTGAAGTTGCCCCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAAGTAGGCAGCATGGTGAATGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1800
Approximate temperature
60°C
  
PCR data   Exp. ID 32522
Forward primer (5'-3')
ACTTCTAAATTTTGAAGTTGCCCCTG
Digested band sizes (using DraI)
Solanum pennellii LA716: 1800
Solanum lycopersicum LA925: 700+1100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAAGTAGGCAGCATGGTGAATGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1800
Solanum lycopersicum LA925: 1800
Approximate temperature
60°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At4g31115  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8415 marker 8415
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)