SGN Marker C2_At4g32930

SGN-M8445
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308615 (SGN)
130988 (CGN)
---
Lycopersicon CombinedSingleSGN-U216334---
Solanum tuberosumSingleSGN-U251494---
ArabidopsisSingleAt4g32930 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38700)
Chromosome
11
Position
88.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39874
Forward primer (5'-3')
TCCTCTTCCTATTGGCAAGGGC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGGACACTCCCCCTTTTCATCATAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26888)
Chromosome
4
Position
15.90 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32527
Forward primer (5'-3')
TCCTCTTCCTATTGGCAAGGGC
 
 
Mg+2 concentration
35mM
Reverse primer (5'-3')
TGGACACTCCCCCTTTTCATCATAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32528
Forward primer (5'-3')
TCCTCTTCCTATTGGCAAGGGC
 
 
Mg+2 concentration
35mM
Reverse primer (5'-3')
TGGACACTCCCCCTTTTCATCATAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32529
Forward primer (5'-3')
TCCTCTTCCTATTGGCAAGGGC
 
 
Mg+2 concentration
35mM
Reverse primer (5'-3')
TGGACACTCCCCCTTTTCATCATAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32530
Forward primer (5'-3')
TCCTCTTCCTATTGGCAAGGGC
Digested band sizes (using HinfI)
Solanum pennellii LA716: 525+600
Solanum lycopersicum LA925: 250+350+525
Mg+2 concentration
35mM
Reverse primer (5'-3')
TGGACACTCCCCCTTTTCATCATAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At4g32930  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8445 marker 8445
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)