SGN Marker C2_At4g33090

SGN-M8447
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U197986---
Lycopersicon CombinedMultipleSGN-U216824---
Solanum tuberosumSingleSGN-U247725---
ArabidopsisSingleAt4g33090 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38702)
Chromosome
8
Position
20.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41619
Forward primer (5'-3')
AGAATTGTAGCTGAGGCTGTTCCTGAC
Accessions and product sizes
Solanum lycopersicum TA209
2400
Solanum pennellii TA56
2800
Approximate temperature
55°C
Reverse primer (5'-3')
TTCTTTAGGATCCCAACCAAGTCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26890)
Chromosome
4
Position
15.97 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g33090  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8447 marker 8447
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)