SGN Marker C2_At4g33350

SGN-M8451
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300526 (SGN)
120722 (CGN)
---
Capsicum annuumSingleSGN-U197914---
Lycopersicon CombinedSingleSGN-U217889---
Solanum tuberosumSingleSGN-U265186---
ArabidopsisSingleAt4g33350 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38704)
Chromosome
4
Position
102.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39876
Forward primer (5'-3')
TATCATCTATCTCTTCCGTTCGCTTC
Accessions and product sizes
Solanum pennellii TA56
425
Solanum lycopersicum TA209
425
Approximate temperature
55°C
Reverse primer (5'-3')
ATGCGATTCCTTCAACCTTCAAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
425
Solanum lycopersicum TA209
325
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26894)
Chromosome
4
Position
16.07 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At4g33350  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8451 marker 8451
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)