SGN Marker C2_At4g33680

SGN-M8458
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310411 (SGN)
132586 (CGN)
---
Capsicum annuumSingleSGN-U200881---
Lycopersicon CombinedSingleSGN-U219686---
Solanum tuberosumSingleSGN-U247676---
ArabidopsisSingleAt4g33680 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26901)
Chromosome
4
Position
16.17 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41625
Forward primer (5'-3')
TGGTGACACTACCGAGCCCATTC
Accessions and product sizes
Solanum pennellii TA56
1100
Solanum lycopersicum TA209
1100
Approximate temperature
55°C
Reverse primer (5'-3')
TCCTTGCTCAGCACCATAACCAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
800
Solanum lycopersicum TA209
600
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 11552
Forward primer (5'-3')
TGGTGACACTACCGAGCCCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCTCAGCACCATAACCAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 11553
Forward primer (5'-3')
TGGTGACACTACCGAGCCCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCTCAGCACCATAACCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 11554
Forward primer (5'-3')
TGGTGACACTACCGAGCCCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCTCAGCACCATAACCAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 13536
Forward primer (5'-3')
TGGTGACACTACCGAGCCCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCTCAGCACCATAACCAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13537
Forward primer (5'-3')
TGGTGACACTACCGAGCCCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCTCAGCACCATAACCAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 480
Approximate temperature
55°C
  
PCR data   Exp. ID 13538
Forward primer (5'-3')
TGGTGACACTACCGAGCCCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCTCAGCACCATAACCAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13539
Forward primer (5'-3')
TGGTGACACTACCGAGCCCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCTCAGCACCATAACCAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13540
Forward primer (5'-3')
TGGTGACACTACCGAGCCCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCTCAGCACCATAACCAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13541
Forward primer (5'-3')
TGGTGACACTACCGAGCCCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCTCAGCACCATAACCAC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13542
Forward primer (5'-3')
TGGTGACACTACCGAGCCCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCTCAGCACCATAACCAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13543
Forward primer (5'-3')
TGGTGACACTACCGAGCCCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCTCAGCACCATAACCAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 480
Approximate temperature
55°C
  
PCR data   Exp. ID 13544
Forward primer (5'-3')
TGGTGACACTACCGAGCCCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCTCAGCACCATAACCAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 480
Approximate temperature
55°C
  
PCR data   Exp. ID 13545
Forward primer (5'-3')
TGGTGACACTACCGAGCCCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCTCAGCACCATAACCAC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 480
Approximate temperature
55°C
  
PCR data   Exp. ID 32645
Forward primer (5'-3')
TGGTGACACTACCGAGCCCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCTCAGCACCATAACCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 480
Approximate temperature
55°C
  
PCR data   Exp. ID 33134
Forward primer (5'-3')
TGGTGACACTACCGAGCCCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCTCAGCACCATAACCAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 480
Approximate temperature
55°C
  
PCR data   Exp. ID 33135
Forward primer (5'-3')
TGGTGACACTACCGAGCCCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCTCAGCACCATAACCAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 480
Approximate temperature
55°C
  
PCR data   Exp. ID 33136
Forward primer (5'-3')
TGGTGACACTACCGAGCCCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCTCAGCACCATAACCAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33137
Forward primer (5'-3')
TGGTGACACTACCGAGCCCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCTCAGCACCATAACCAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33138
Forward primer (5'-3')
TGGTGACACTACCGAGCCCATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTGCTCAGCACCATAACCAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At4g33680  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8458 marker 8458
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)