Sol Genomics Network

SGN Marker C2_At4g34090

SGN-M8462
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

Synonyms

None

Locus associations

None

Orthologs in this COSII group

Species	Copies	Sequence ID	CDS/Edited sequence	Peptide sequence	Predicted introns
Coffee	Single	304955 (SGN) 121764 (CGN)	-	-	-
Solanum tuberosum	Single	SGN-U264785	-	-	-
Arabidopsis	Single	At4g34090 on TAIR	-	-	-

Mapped locations

Map: Tobacco N. tomentosiformis
Map version 91 (location: 46734)
Chromosome 2
Position 6.70 cM
Confidence I(LOD2)
Protocol dCAPS

Tobacco N. tomentosiformis

Map: Tobacco N. acuminata
Map version 89 (location: 46517)
Chromosome 2
Position 70.40 cM
Confidence F(LOD3)
Protocol CAPS

Tobacco N. acuminata

Map: Tomato-EXPEN 2000
Map version 52 (location: 38709)
Chromosome 2
Position 134.00 cM
Confidence I
Protocol CAPS

Tomato-EXPEN 2000

PCR data Exp. ID 39879

Forward primer (5'-3')

TGTTACGATGGCCAACTGCCCC

Accessions and product sizes

Solanum lycopersicum TA209

550

Solanum pennellii TA56

550

Approximate temperature

50°C

Reverse primer (5'-3')

TCTTCCACCAAAACCCTGTGAATG

Digested band sizes (using amplicon difference)

Solanum pennellii TA56

550

Solanum lycopersicum TA209

500

Mg⁺² concentration

1.5mM

Enzymes

Map: Arabidopsis COSII
Map version 44 (location: 26906)
Chromosome 4
Position 16.33 MB
Confidence uncalculated
Protocol CAPS

Arabidopsis COSII

Other PCR data

PCR data Exp. ID 32535
Forward primer (5'-3') TGTTACGATGGCCAACTGCCCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCTTCCACCAAAACCCTGTGAATG	Enzymes
Accessions and product sizes Solanum pennellii LA716: 400	Approximate temperature 55°C

PCR data Exp. ID 32536
Forward primer (5'-3') TGTTACGATGGCCAACTGCCCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCTTCCACCAAAACCCTGTGAATG	Enzymes
Accessions and product sizes Solanum lycopersicum LA925: 400	Approximate temperature 55°C

PCR data Exp. ID 32537
Forward primer (5'-3') TGTTACGATGGCCAACTGCCCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCTTCCACCAAAACCCTGTGAATG	Enzymes
Accessions and product sizes Solanum pimpinellifolium LA1589: 400	Approximate temperature 55°C

PCR data Exp. ID 32538
Forward primer (5'-3') TGTTACGATGGCCAACTGCCCC	Digested band sizes (using AluI) Solanum pennellii LA716: 250 Solanum lycopersicum LA925: 275	Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCTTCCACCAAAACCCTGTGAATG	Enzymes
Accessions and product sizes Solanum pennellii LA716: 400 Solanum lycopersicum LA925: 400	Approximate temperature 55°C

Universal primers for Asterid species

No additional PCR data found.

Other COSII sequence data

Related Markers

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of C2_At4g34090

%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8462 marker 8462

User comments

Please wait, checking for comments. (If comments do not show up, access them here)

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer