Sol Genomics Network

SGN Marker C2_At4g35930

SGN-M8486
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

Synonyms

None

Locus associations

None

Orthologs in this COSII group

Species	Copies	Sequence ID	CDS/Edited sequence	Peptide sequence	Predicted introns
Coffee	Single	311540 (SGN) 128097 (CGN)	-	-	-
Capsicum annuum	Single	SGN-U200906	-	-	-
Lycopersicon Combined	Single	SGN-U221671	-	-	-
Arabidopsis	Single	At4g35930 on TAIR	-	-	-

Mapped locations

Map: Solanum michoacanum 2011
Map version 155 (location: 109244)
Chromosome 3
Position 7.20 cM
Confidence uncalculated
Protocol CAPS

Solanum michoacanum 2011

Map: Tobacco N. tomentosiformis
Map version 91 (location: 46736)
Chromosome 9
Position 52.90 cM
Confidence CF(LOD3)
Protocol CAPS

Tobacco N. tomentosiformis

Map: Tobacco N. acuminata
Map version 89 (location: 46519)
Chromosome 9
Position 50.50 cM
Confidence CF(LOD3)
Protocol CAPS

Tobacco N. acuminata

Map: Tomato-EXPEN 2000
Map version 52 (location: 38717)
Chromosome 3
Position 52.50 cM
Confidence I
Protocol CAPS

Tomato-EXPEN 2000

PCR data Exp. ID 39887

Forward primer (5'-3')

ACTAAGGCATCAGCTGCTAAATCTTG

Accessions and product sizes

Approximate temperature

Unknown

Reverse primer (5'-3')

TTGCCTGAATTACTGCCTTCCTG

Digested band sizes (using unknown enzyme)

Mg⁺² concentration

1.5mM

Enzymes

Map: Arabidopsis COSII
Map version 44 (location: 26931)
Chromosome 4
Position 17.02 MB
Confidence uncalculated
Protocol CAPS

Arabidopsis COSII

Other PCR data

PCR data Exp. ID 32547
Forward primer (5'-3') ACTAAGGCATCAGCTGCTAAATCTTG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTGCCTGAATTACTGCCTTCCTG	Enzymes
Accessions and product sizes Solanum pennellii LA716: 1250	Approximate temperature 55°C

PCR data Exp. ID 32548
Forward primer (5'-3') ACTAAGGCATCAGCTGCTAAATCTTG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTGCCTGAATTACTGCCTTCCTG	Enzymes
Accessions and product sizes Solanum lycopersicum LA925: 1250	Approximate temperature 55°C

PCR data Exp. ID 32549
Forward primer (5'-3') ACTAAGGCATCAGCTGCTAAATCTTG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTGCCTGAATTACTGCCTTCCTG	Enzymes
Accessions and product sizes Solanum pimpinellifolium LA1589: 1250	Approximate temperature 55°C

PCR data Exp. ID 32550
Forward primer (5'-3') ACTAAGGCATCAGCTGCTAAATCTTG	Digested band sizes (using HincII) Solanum lycopersicum LA925: 800+425 Solanum pennellii LA716: 800+450	Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTGCCTGAATTACTGCCTTCCTG	Enzymes
Accessions and product sizes Solanum pennellii LA716: 1250 Solanum lycopersicum LA925: 1250	Approximate temperature 55°C

Universal primers for Asterid species

No additional PCR data found.

Other COSII sequence data

Related Markers

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of C2_At4g35930

%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8486 marker 8486

User comments

Please wait, checking for comments. (If comments do not show up, access them here)

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer