SGN Marker C2_At4g37000

SGN-M8497
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311154 (SGN)
132535 (CGN)
---
Capsicum annuumSingleSGN-U198203---
Lycopersicon CombinedMultipleSGN-U218384---
Solanum tuberosumSingleSGN-U246977---
ArabidopsisSingleAt4g37000 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26942)
Chromosome
4
Position
17.44 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41641
Forward primer (5'-3')
ACACTTCAATTCTCACACAATCACTCCC
Accessions and product sizes
Solanum lycopersicum TA209
650
Solanum pennellii TA56
700
Approximate temperature
55°C
Reverse primer (5'-3')
AGAAGAGAAATAAGGCTTTACCTCAGG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
650
Solanum pennellii TA56
700
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 11589
Forward primer (5'-3')
ACACTTCAATTCTCACACAATCACTCCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAAGAGAAATAAGGCTTTACCTCAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 3000
Approximate temperature
55°C
  
PCR data   Exp. ID 32554
Forward primer (5'-3')
ACACTTCAATTCTCACACAATCACTCCC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AGAAGAGAAATAAGGCTTTACCTCAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Approximate temperature
53°C
  
PCR data   Exp. ID 32555
Forward primer (5'-3')
ACACTTCAATTCTCACACAATCACTCCC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AGAAGAGAAATAAGGCTTTACCTCAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1000
Approximate temperature
53°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At4g37000  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8497 marker 8497
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)