SGN Marker TG61

SGN-M85

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2100
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
NAACCATAAATATCAGGAAAAGAATACATGATTGTATAATCCTGACAAATATCTGATGATTAAGAGTATAAGAACCTATAAGCTTTAGTT
CTTGCAACAACTACAACAAAATCACAGTATAACAATTTGATCCCTATTTTCCATTTAAAACCTTTGCCAGACTAAAAGTTGTGCGGCCAC
AATCTCATAAACAGGAAACAAGTAATATCAGCTTCAGAATTTATCATATCATTAATTATGCTCCTGTCTTGTATGAATCAACGCGCACCA
GTAATCAAGCACTTTAAGTTTTCATCCCTACAGTACTAGCCACCTTCCTTTTCCTGACTGATGATAGGTCATAAGTCATCTGATACACAC
TAGAAAGGAGTTTCACTCCCTTTAAGAGGTCCACCTTGCAAATAGCTGCGAGA
Reverse sequence
GTATAGCTTTTTTATTTAGGCAAAGCTTATTTGATCCGGAAAATCATTGAAATTCTTGTACGGCTATGAAGTGGTACGGTTAAGACTGGT
TTATAGCTGTAGGATCAAGAATAACATTGTAGTTGCGTAAAACAGATTTTGCTAATTGGTCATTTTAAATTTTCTGTCCATCTCGTTGGT
AGTCTTCGAAAAGAATATAGTTGACTTAGGGATTGACTGAATACGCTGCCCAAACCAGATTGTTGTCAGATGCATATCAGAAATGCAATG
CCTTAATCAGTGACCAAAAATGGACAAAATTTTCTCATGAGCTGCCTCAAAGAATGAGTGAGTGGAACAGGGAGCTGACTTAATGCAGTA
CTTTGAAGTGTTTAGGCAGTTTCTAGGGTGATTTTATATATATATATATATATATATATACACTATTGCCAGATATGTATGAAGGATCAA
ATAAGCTATTTGAATTTAGTTATCGAGGAAGTTGTAT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53365)
Chromosome
7
Position
30.12 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50415)
Chromosome
7
Position
3.59 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48347)
Chromosome
7
Position
11.88 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40112)
Chromosome
7
Position
9.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8018)
Chromosome
7
Position
17.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8019)
Chromosome
7
Position
11.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8023)
Chromosome
7
Position
51.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG61 was used as an overgo probe on plate 8 [well B6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCTCCTGTCTTGTATGAATCAACG
B sequence
CTTGATTACTGGTGCGCGTTGATT
AB sequence
GCTCCTGTCTTGTATGAATCAACGCGCACC
Marker sequence
NAACCATAAATATCAGGAAAAGAATACATGATTGTATAATCCTGACAAAT
ATCTGATGATTAAGAGTATAAGAACCTATAAGCTTTAGTTCTTGCAACAA
CTACAACAAAATCACAGTATAACAATTTGATCCCTATTTTCCATTTAAAA
CCTTTGCCAGACTAAAAGTTGTGCGGCCACAATCTCATAAACAGGAAACA
AGTAATATCAGCTTCAGAATTTATCATATCATTAATTATGCTCCTGTCTT
GTATGAATCAACGCGCACCAGTAATCAAGCACTTTAAGTTTTCATCCCTA
CAGTACTAGCCACCTTCCTTTTCCTGACTGATGATAGGTCATAAGTCATC
TGATACACACTAGAAAGGAGTTTCACTCCCTTTAAGAGGTCCACCTTGCA
AATAGCTGCGAGA
Genomic location of TG61  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D85 marker 85
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)