SGN Marker C2_At4g38240

SGN-M8513
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303160 (SGN)
124662 (CGN)
---
Lycopersicon CombinedSingleSGN-U220499---
Solanum tuberosumMultipleSGN-U245673---
ArabidopsisSingleAt4g38240 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38724)
Chromosome
1
Position
165.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39893
Forward primer (5'-3')
AAGATTAGCCAGCAGCAAGGAAG
Accessions and product sizes
Solanum lycopersicum TA209
2200
Solanum pennellii TA56
2000
Approximate temperature
53°C
Reverse primer (5'-3')
ATTGTCGGCACTCCTGGTCCTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26958)
Chromosome
4
Position
17.93 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11597
Forward primer (5'-3')
AAGATTAGCCAGCAGCAAGGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGTCGGCACTCCTGGTCCTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 11598
Forward primer (5'-3')
AAGATTAGCCAGCAGCAAGGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGTCGGCACTCCTGGTCCTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13568
Forward primer (5'-3')
AAGATTAGCCAGCAGCAAGGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGTCGGCACTCCTGGTCCTG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13569
Forward primer (5'-3')
AAGATTAGCCAGCAGCAAGGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGTCGGCACTCCTGGTCCTG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 13570
Forward primer (5'-3')
AAGATTAGCCAGCAGCAAGGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGTCGGCACTCCTGGTCCTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13571
Forward primer (5'-3')
AAGATTAGCCAGCAGCAAGGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGTCGGCACTCCTGGTCCTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13572
Forward primer (5'-3')
AAGATTAGCCAGCAGCAAGGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGTCGGCACTCCTGGTCCTG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13573
Forward primer (5'-3')
AAGATTAGCCAGCAGCAAGGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGTCGGCACTCCTGGTCCTG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13574
Forward primer (5'-3')
AAGATTAGCCAGCAGCAAGGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGTCGGCACTCCTGGTCCTG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13575
Forward primer (5'-3')
AAGATTAGCCAGCAGCAAGGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGTCGGCACTCCTGGTCCTG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 32646
Forward primer (5'-3')
AAGATTAGCCAGCAGCAAGGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGTCGGCACTCCTGGTCCTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33145
Forward primer (5'-3')
AAGATTAGCCAGCAGCAAGGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGTCGGCACTCCTGGTCCTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33146
Forward primer (5'-3')
AAGATTAGCCAGCAGCAAGGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGTCGGCACTCCTGGTCCTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33147
Forward primer (5'-3')
AAGATTAGCCAGCAGCAAGGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGTCGGCACTCCTGGTCCTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 33148
Forward primer (5'-3')
AAGATTAGCCAGCAGCAAGGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGTCGGCACTCCTGGTCCTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 11599
Forward primer (5'-3')
AAGATTAGCCAGCAGCAAGGAAG
Digested band sizes (using DpnII)
Solanum pennellii LA716: 700
Solanum lycopersicum LA925: 650
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGTCGGCACTCCTGGTCCTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: DpnII
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At4g38240  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8513 marker 8513
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)