SGN Marker C2_At5g04200

SGN-M8569
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306958 (SGN)
128533 (CGN)
---
Capsicum annuumSingleSGN-U204887---
Lycopersicon CombinedSingleSGN-U240638---
ArabidopsisSingleAt5g04200 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46741)
Chromosome
10
Position
11.60 cM
Confidence
F(LOD3)
Protocol
dCAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46520)
Chromosome
10
Position
25.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41504)
Chromosome
10
Position
111.50 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43480
Forward primer (5'-3')
AAACACACGTTACAGGTTACATGGATG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCTCTCTCTTTGTCAATTAGGCCTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38742)
Chromosome
10
Position
57.60 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41666
Forward primer (5'-3')
AAACACACGTTACAGGTTACATGGATG
Accessions and product sizes
Solanum pennellii TA56
350
Solanum lycopersicum TA209
350
Approximate temperature
55°C
Reverse primer (5'-3')
TCTCTCTCTTTGTCAATTAGGCCTCC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
350
Solanum lycopersicum TA209
250
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27018)
Chromosome
5
Position
1.15 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g04200  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8569 marker 8569
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)