SGN Marker CD4

SGN-M86

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
600
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
not available
Reverse sequence
GGGGTGTGATCCCTGATCTAAACGGGGATAGGCTCAGGAGCCGGATCCGAGGGAGTACCACTACTTCCATTGAGGACAGTCACATTGCCA
TCTGAATCAACGTCCACGATAACTGAATCACCTTCTTTAATCTCATTTGCAAGCATTTTCTCAGCCATGCTGTCCTCTAAAAGTCTCATA
ATAGCTCTTCTCAGAGGTCGTGCTCCATAGCTAGGGTTGTATCCCTCGTCAACCACCCTGTCTCTAAACCTCTCTGTCACTTGAAGTTCT
ATCTCCTTAACTTTCAACCTCTCAAAGACCTCCTTAAGCATGATATCAGCTATCTCCTTAACCTCTAACTTAGTGAGCTGACGGAATACA
ATCATCTCATCCAATCTGTTCAAAAACTCTGGCCTGAAGTACTGCTTCAATTCTTCTGTCACTAAGCTCTTGATGCGATTGTAACTGCTA
TCCTTCTCATCAAGGTCGAGATCAAAACC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1606731.7e-99366 (76.4% of RFLP seq)-
SGN-U1436403e-107447 (93.3% of RFLP seq)-
SGN-U143638468 (97.7% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51723)
Chromosome
3
Position
78.80 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_1_Late_blight_3 MQTL_2_Late_blight_3 MQTL_3_Late_blight_3
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8024)
Chromosome
3
Position
98.40 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8025)
Chromosome
12
Position
42.60 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8026)
Chromosome
3
Position
49.60 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Potato-TXB 1992
Overgo hybridization and physical mapping 
CD4 was used as an overgo probe on plate 3 [well C11]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P241N03,   P033A22,   P115C02,   P147C11,   P302P09,   P047K22,   P113G20,   P254N21,   P113E22,   P303G20,   P106G05,   P226M05,   P300K06,   P167L01,   P260L05,   P012A08,   P047K14,   P015I17,   P064M23,   P204B18,   P165E04,   P165K17,   P142F08,   P286H05

 Overgo Sequences

A sequence
GGGAGTACCACTACTTCCATTGAG
B sequence
TGGCAATGTGACTGTCCTCAATGG
AB sequence
GGGAGTACCACTACTTCCATTGAGGACAGT
Marker sequence
GGGGTGTGATCCCTGATCTAAACGGGGATAGGCTCAGGAGCCGGATCCGA
GGGAGTACCACTACTTCCATTGAGGACAGTCACATTGCCATCTGAATCAA
CGTCCACGATAACTGAATCACCTTCTTTAATCTCATTTGCAAGCATTTTC
TCAGCCATGCTGTCCTCTAAAAGTCTCATAATAGCTCTTCTCAGAGGTCG
TGCTCCATAGCTAGGGTTGTATCCCTCGTCAACCACCCTGTCTCTAAACC
TCTCTGTCACTTGAAGTTCTATCTCCTTAACTTTCAACCTCTCAAAGACC
TCCTTAAGCATGATATCAGCTATCTCCTTAACCTCTAACTTAGTGAGCTG
ACGGAATACAATCATCTCATCCAATCTGTTCAAAAACTCTGGCCTGAAGT
ACTGCTTCAATTCTTCTGTCACTAAGCTCTTGATGCGATTGTAACTGCTA
TCCTTCTCATCAAGGTCGAGATCAAAACC
Genomic location of CD4  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D86 marker 86
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)