SGN Marker SSR192

SGN-M865

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 40 High: 45
Repeat motif: ATC   Repeat number: 6
Repeat motif:    Repeat number:
Forward primer: ACAACATGGGAAGCACTTGA
Reverse primer: ATTAAATTGGGCCATGGTGA
Predicted size: 168
Derivations 
This marker was derived from EST read SGN-E98975
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43784)
Chromosome
1
Position
23.40 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44787
Forward primer (5'-3')
ACAACATGGGAAGCACTTGA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATTAAATTGGGCCATGGTGA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43244)
Chromosome
1
Position
32.90 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44601
Forward primer (5'-3')
ACAACATGGGAAGCACTTGA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATTAAATTGGGCCATGGTGA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40781)
Chromosome
1
Position
41.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39186)
Chromosome
1
Position
31.50 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 4
Forward primer (5'-3')
ACAACATGGGAAGCACTTGA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTAAATTGGGCCATGGTGA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 169+169
Solanum lycopersicum LA925: 169+165
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR192 was used as an overgo probe on plate 9 [well E3]

Plausible BAC Matches:   P142O05,   P144L08,   P299N19,   P017P20,   P100B24,   P138O20,   P262N20,   P056M23,   P194M14,   P238D05,   P235J18,   P290O12

 Overgo Sequences

A sequence
AATCATATCGTCGCCGACGAATCC
B sequence
ACGAACATCGTACGGTGGATTCGT
AB sequence
AATCATATCGTCGCCGACGAATCCACCGTA
Marker sequence
CCTTAAACAACATGGGAAGCACTTGAAAAAAATTGAAAATTACAAAAATA
CTTGTTCAACCTAATTTAACATTGATCATCATCATCATCATCATGAAATT
AATTAAAGAGACAAAATTTGAAGAAAACCTTGATAGGTAACACCACCATT
TTCTTCACCATGGCCCAATTTAATCATAGCTTTGATATCATCATCATCAA
CTTGAAGCCCAGCCCAACTCAAATAACTTTTCAAATCCTCAACCCCAACT
TTACCATCTCCATCTTTGTCAATCACCTTGAAGACATCCTCCATTACATT
CATTTCTCCTCGTAATGCTCCGTTTTTCCTCTTCTCCTCGCTGTTTCTGC
TAATAGAACTATCCAAAACCTTCTCGAAATCCTCAAATTCAACGTATCCA
TCTTCGTTCGAATCCGCCACCGTCATCATCGTACCAATCATATCGTCGCC
GACGAATCCACCGTACGATGTTCGTAGATCTTCTCTGCTAATCTTTCCAT
CGCGGTCAACGTCCAAAACGTCGAATGCTGACCGCAGATTTGGTTTTCCG
GCGCCGGCGGCAGAATGCAAAACACTTCCGGTGGGACACATTTTTCCGGT
GTGTTTTGCAGGTAATTGAAGAAGTAAAATCTTTTGTAAATTTAAGCTTG
GTGGCAATTCAACC
Genomic location of SSR192  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D865 marker 865
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)