SGN Marker C2_At5g11480

SGN-M8650
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309692 (SGN)
129388 (CGN)
---
Lycopersicon CombinedSingleSGN-U226270---
Solanum tuberosumSingleSGN-U251349---
ArabidopsisSingleAt5g11480 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46749)
Chromosome
8
Position
35.40 cM
Confidence
I(LOD2)
Protocol
dCAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41510)
Chromosome
1
Position
168.40 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43486
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38775)
Chromosome
8
Position
39.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39918
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
Accessions and product sizes
Solanum pennellii TA56
400
Solanum lycopersicum TA209
400
Approximate temperature
55°C
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27107)
Chromosome
5
Position
3.67 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11685
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 11686
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 11687
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 13678
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 13679
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 13680
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 13681
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 13682
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 13683
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 13684
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 13685
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 13686
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 32652
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 33189
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 33190
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 33191
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 33192
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 33193
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 11688
Forward primer (5'-3')
TCCTCATAGATGCTAGCATTCCTGC
Digested band sizes (using DpnII)
Solanum pennellii LA716: 220
Solanum lycopersicum LA925: 380
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCAGTCTTTTTCTTTTTCCG
Enzymes
All possible enzymes for pennellii and and lycopersicum: DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 530
Solanum pennellii LA716: 530
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At5g11480  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8650 marker 8650
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)