SGN Marker C2_At5g13030

SGN-M8672
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle312156 (SGN)
129066 (CGN)
---
Capsicum annuumSingleSGN-U200740---
Lycopersicon CombinedMultipleSGN-U225360---
Solanum tuberosumSingleSGN-U253572---
ArabidopsisSingleAt5g13030 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46752)
Chromosome
11
Position
90.60 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38782)
Chromosome
1
Position
15.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39924
Forward primer (5'-3')
TCCAAGAACAGATACCATTCCAAGAG
Accessions and product sizes
Solanum pennellii TA56
150
Solanum lycopersicum TA209
150
Approximate temperature
55°C
Reverse primer (5'-3')
AACAGAAGGCAACATTTTCGTATAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27130)
Chromosome
5
Position
4.14 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11707
Forward primer (5'-3')
TCCAAGAACAGATACCATTCCAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGAAGGCAACATTTTCGTATAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 11708
Forward primer (5'-3')
TCCAAGAACAGATACCATTCCAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGAAGGCAACATTTTCGTATAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 11709
Forward primer (5'-3')
TCCAAGAACAGATACCATTCCAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGAAGGCAACATTTTCGTATAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 13708
Forward primer (5'-3')
TCCAAGAACAGATACCATTCCAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGAAGGCAACATTTTCGTATAGC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 13709
Forward primer (5'-3')
TCCAAGAACAGATACCATTCCAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGAAGGCAACATTTTCGTATAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13710
Forward primer (5'-3')
TCCAAGAACAGATACCATTCCAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGAAGGCAACATTTTCGTATAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13711
Forward primer (5'-3')
TCCAAGAACAGATACCATTCCAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGAAGGCAACATTTTCGTATAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32654
Forward primer (5'-3')
TCCAAGAACAGATACCATTCCAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGAAGGCAACATTTTCGTATAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 33202
Forward primer (5'-3')
TCCAAGAACAGATACCATTCCAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGAAGGCAACATTTTCGTATAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 33203
Forward primer (5'-3')
TCCAAGAACAGATACCATTCCAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGAAGGCAACATTTTCGTATAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 33204
Forward primer (5'-3')
TCCAAGAACAGATACCATTCCAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGAAGGCAACATTTTCGTATAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33205
Forward primer (5'-3')
TCCAAGAACAGATACCATTCCAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGAAGGCAACATTTTCGTATAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33206
Forward primer (5'-3')
TCCAAGAACAGATACCATTCCAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGAAGGCAACATTTTCGTATAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 11710
Forward primer (5'-3')
TCCAAGAACAGATACCATTCCAAGAG
Digested band sizes (using MspI)
Solanum lycopersicum LA925: 750+900
Solanum pennellii LA716: 750+850
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGAAGGCAACATTTTCGTATAGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: MspI
All possible enzymes for lycopersicum and pimpinellifolium: MspI
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Solanum lycopersicum LA925: 1650
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At5g13030  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8672 marker 8672
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)