SGN Marker C2_At5g13700

SGN-M8688
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U204700---
Lycopersicon CombinedMultipleSGN-U216957---
Solanum tuberosumSingleSGN-U261898---
ArabidopsisSingleAt5g13700 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42249)
Chromosome
1
Position
71.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43817
Forward primer (5'-3')
TCATTCTTCATGATTTTGAAATGGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGTCGACTGTCCATAATTTTACCCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38790)
Chromosome
1
Position
46.10 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39930
Forward primer (5'-3')
TCATTCTTCATGATTTTGAAATGGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGTCGACTGTCCATAATTTTACCCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27147)
Chromosome
5
Position
4.42 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11725
Forward primer (5'-3')
TCATTCTTCATGATTTTGAAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCGACTGTCCATAATTTTACCCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 290
Approximate temperature
55°C
  
PCR data   Exp. ID 11726
Forward primer (5'-3')
TCATTCTTCATGATTTTGAAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCGACTGTCCATAATTTTACCCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 290
Approximate temperature
55°C
  
PCR data   Exp. ID 11727
Forward primer (5'-3')
TCATTCTTCATGATTTTGAAATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCGACTGTCCATAATTTTACCCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 290
Approximate temperature
55°C
  
PCR data   Exp. ID 32574
Forward primer (5'-3')
TCATTCTTCATGATTTTGAAATGGC
Digested band sizes (using AflII)
Solanum lycopersicum LA925: 200
Solanum pennellii LA716: 290
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCGACTGTCCATAATTTTACCCTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AflII
All possible enzymes for lycopersicum and pimpinellifolium: CfoI/HhaI
  
Accessions and product sizes
Solanum pennellii LA716: 290
Solanum lycopersicum LA925: 290
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At5g13700F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At5g13700F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g13700  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8688 marker 8688
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)