SGN Marker TG62

SGN-M87

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CAAAATGCTTCAGCTACTGGCTAAATGAAGTATGTTCTCAACATATTCACAAGCTTCTGTCTTCGAAGCTCAAGAAGTGTCGGTATTATC
TGAATTAAATAGTAAAGCAAAGAGATGGTTTTATGTTTCTTAAGCAGCATTTCTTAGCTTAACGGCCCTCCAGATATATGGTGGACAAAA
TAGAATCCATTAGATATAACAAATGGGATTAGTATAATGATCTTTTACTTTGTTAGATGATCATACTAACAGATTGCAAGTTAATCATAT
CCAACATATTCTGTAGATATTTCACATTGGCTAGCATGAGGAAAGGTCATGTAGGAAATTGAATAGAGTTCAATTTTGGGAAAAGTTGCA
TTGAAGAAGGTAACTTCAACAAACGTGTGAAAAAATCACATTTGAGTTGCCCGCTCACCATCGTGATTCCAGTACGAACTACTCAAAAAT
TTACTTTTGAGCCTTAAACATCATTTTAAGCCTTGAAAAGCTGCTTTTGAAAAGATCTAAGCAAGAT
Reverse sequence
GGAGAATATTGTCACTCTATCAGATAGTTCAAAACTATCGGAGAATGAAATGGTCAATTCTTCTCACAAGATATTCATGCCTAGTTGCAG
TGTCCGAATTAACATAACATGCTCAATTTTCATATCTTGCAGCAAAATTTATCATTGAAACTCTCTGAGATGGAAACAGAGAACAAAGAC
CATATTGGAAAGCTTCAATCAGACATGCAGAAAAAGGAAGATGAGATTCATGTTTTACGCAAGGAAATTGACAATTACACGGAAACAGTG
GATTCACTGGAGAAGCATGTTACAGAGATTAACAATAAATTGGAGGAGAAAGATCAGCTTGTTCAGGAACTTCAGGACAAGGAGAAGCAG
TTGGAAGCTGACAGAGAAAAGGTTTTTACTACGGATACTTTTAGTTCTACAAATTCTATTATAACCAATACAATGTGTTCAAGTGACTAG
TGTTTTGCACCTTGTTGCAGATTCAGGCATCTTTGCTTGCTGCTGAAAGCAAGCTCACAGAATCCAAAAAGCAGTATGATCAGATGT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53368)
Chromosome
4
Position
60.26 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Pepper Capsicum   
Map version
65 (location: 42842)
Chromosome
4
Position
102.10 cM
Confidence
uncalculated
Protocol
RFLP


Pepper Capsicum

Map: Eggplant-COSII   
Map version
63 (location: 42496)
Chromosome
4
Position
69.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-COSII

Map: Pepper-COSII   
Map version
58 (location: 41637)
Chromosome
4
Position
95.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Pepper-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40114)
Chromosome
4
Position
82.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Pepper-FAO3   
Map version
31 (location: 8031)
Chromosome
4
Position
40.81 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-FAO3

Map: Eggplant-LXM 2002   
Map version
29 (location: 8028)
Chromosome
4
Position
47.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8027)
Chromosome
4
Position
63.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8033)
Chromosome
4
Position
29.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG62 was used as an overgo probe on plate 8 [well A5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACATTTGAGTTGCCCGCTCACCAT
B sequence
TCGTACTGGAATCACGATGGTGAG
AB sequence
ACATTTGAGTTGCCCGCTCACCATCGTGAT
Marker sequence
CAAAATGCTTCAGCTACTGGCTAAATGAAGTATGTTCTCAACATATTCAC
AAGCTTCTGTCTTCGAAGCTCAAGAAGTGTCGGTATTATCTGAATTAAAT
AGTAAAGCAAAGAGATGGTTTTATGTTTCTTAAGCAGCATTTCTTAGCTT
AACGGCCCTCCAGATATATGGTGGACAAAATAGAATCCATTAGATATAAC
AAATGGGATTAGTATAATGATCTTTTACTTTGTTAGATGATCATACTAAC
AGATTGCAAGTTAATCATATCCAACATATTCTGTAGATATTTCACATTGG
CTAGCATGAGGAAAGGTCATGTAGGAAATTGAATAGAGTTCAATTTTGGG
AAAAGTTGCATTGAAGAAGGTAACTTCAACAAACGTGTGAAAAAATCACA
TTTGAGTTGCCCGCTCACCATCGTGATTCCAGTACGAACTACTCAAAAAT
TTACTTTTGAGCCTTAAACATCATTTTAAGCCTTGAAAAGCTGCTTTTGA
AAAGATCTAAGCAAGAT
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG62  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D87 marker 87
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)