SGN Marker C2_At5g16630

SGN-M8725
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303076 (SGN)
124411 (CGN)
---
Solanum tuberosumSingleSGN-U267825---
ArabidopsisSingleAt5g16630 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42250)
Chromosome
11
Position
10.10 cM
Confidence
I
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43818
Forward primer (5'-3')
TAAATGCAATCACTGATGGAGAGCA
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
TGCCAATACTGCATCCCACCAAAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41516)
Chromosome
12
Position
7.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43492
Forward primer (5'-3')
TAAATGCAATCACTGATGGAGAGCA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGCCAATACTGCATCCCACCAAAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38796)
Chromosome
11
Position
31.20 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39934
Forward primer (5'-3')
TAAATGCAATCACTGATGGAGAGCA
Accessions and product sizes
Solanum pennellii TA56
400
Solanum lycopersicum TA209
400
Approximate temperature
55°C
Reverse primer (5'-3')
TGCCAATACTGCATCCCACCAAAT
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
350
Solanum pennellii TA56
400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27183)
Chromosome
5
Position
5.46 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g16630  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8725 marker 8725
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)