Sol Genomics Network

SGN Marker C2_At5g18580

SGN-M8754
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

Synonyms

None

Locus associations

None

Orthologs in this COSII group

Species	Copies	Sequence ID	CDS/Edited sequence	Peptide sequence	Predicted introns
Coffee	Multiple	303000 (SGN) 121267 (CGN)	-	-	-
Lycopersicon Combined	Single	SGN-U219212	-	-	-
Solanum tuberosum	Single	SGN-U245972	-	-	-
Arabidopsis	Single	At5g18580 on TAIR	-	-	-

Mapped locations

Map: Tobacco N. tomentosiformis
Map version 91 (location: 46758)
Chromosome 9
Position 42.90 cM
Confidence F(LOD3)
Protocol CAPS

Tobacco N. tomentosiformis

Map: Tobacco N. acuminata
Map version 89 (location: 46528)
Chromosome 9
Position 18.50 cM
Confidence F(LOD3)
Protocol CAPS

Tobacco N. acuminata

Map: Tomato-EXPEN 2000
Map version 52 (location: 38802)
Chromosome 1
Position 34.70 cM
Confidence I(LOD2)
Protocol CAPS

Tomato-EXPEN 2000

PCR data Exp. ID 39938

Forward primer (5'-3')

TGCCACATTGCCTCTGTATGTACAGAAC

Accessions and product sizes

Solanum pennellii TA56

700

Solanum lycopersicum TA209

700

Approximate temperature

55°C

Reverse primer (5'-3')

ATGTCAATTCGGGCTTGAGTAAGTG

Digested band sizes (using amplicon difference)

Solanum pennellii TA56

650

Solanum lycopersicum TA209

700

Mg⁺² concentration

1.5mM

Enzymes

Map: Arabidopsis COSII
Map version 44 (location: 27213)
Chromosome 5
Position 6.18 MB
Confidence uncalculated
Protocol CAPS

Arabidopsis COSII

Other PCR data

PCR data Exp. ID 11754
Forward primer (5'-3') TGCCACATTGCCTCTGTATGTACAGAAC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') ATGTCAATTCGGGCTTGAGTAAGTG	Enzymes
Accessions and product sizes Solanum pennellii LA716: 920	Approximate temperature 55°C

PCR data Exp. ID 11755
Forward primer (5'-3') TGCCACATTGCCTCTGTATGTACAGAAC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') ATGTCAATTCGGGCTTGAGTAAGTG	Enzymes
Accessions and product sizes Solanum lycopersicum LA925: 920	Approximate temperature 55°C

PCR data Exp. ID 11756
Forward primer (5'-3') TGCCACATTGCCTCTGTATGTACAGAAC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') ATGTCAATTCGGGCTTGAGTAAGTG	Enzymes
Accessions and product sizes Solanum pimpinellifolium LA1589: 920	Approximate temperature 55°C

Unigene blast matches for primers

SGN-U219212

Universal primers for Asterid species

No additional PCR data found.

Other COSII sequence data

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Related Markers

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of C2_At5g18580

%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8754 marker 8754

User comments

Please wait, checking for comments. (If comments do not show up, access them here)

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: