SGN Marker C2_At5g20910

SGN-M8787
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple299368 (SGN)
122107 (CGN)
---
Capsicum annuumSingleSGN-U203736---
Solanum tuberosumSingleSGN-U248715---
ArabidopsisSingleAt5g20910 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38811)
Chromosome
8
Position
30.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39943
Forward primer (5'-3')
TGTAGATGACAAGATGCAAGAGTTGCC
Accessions and product sizes
Solanum lycopersicum TA209
350
Solanum pennellii TA56
350
Approximate temperature
55°C
Reverse primer (5'-3')
ATCATCTGTGAGCAATTCATGCCGAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
250
Solanum pennellii TA56
350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27248)
Chromosome
5
Position
7.09 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11782
Forward primer (5'-3')
TGTAGATGACAAGATGCAAGAGTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCATCTGTGAGCAATTCATGCCGAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 220
Approximate temperature
53°C
  
PCR data   Exp. ID 11783
Forward primer (5'-3')
TGTAGATGACAAGATGCAAGAGTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCATCTGTGAGCAATTCATGCCGAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
53°C
  
PCR data   Exp. ID 11784
Forward primer (5'-3')
TGTAGATGACAAGATGCAAGAGTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCATCTGTGAGCAATTCATGCCGAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250
Approximate temperature
53°C
  
PCR data   Exp. ID 11785
Forward primer (5'-3')
TGTAGATGACAAGATGCAAGAGTTGCC
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 220
Solanum lycopersicum LA925: 250
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCATCTGTGAGCAATTCATGCCGAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Solanum pennellii LA716: 220
Approximate temperature
53°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At5g20910  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8787 marker 8787
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)