SGN Marker C2_At5g23050

SGN-M8807
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U199646---
Lycopersicon CombinedMultipleSGN-U226952---
Solanum tuberosumSingleSGN-U262759---
ArabidopsisSingleAt5g23050 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 27268)
Chromosome
5
Position
7.73 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41751
Forward primer (5'-3')
ACTTTGCCTCCACTGGTGAAGCATC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
AGGGCCAATTCACCAATCCCAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g23050  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8807 marker 8807
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)