SGN Marker C2_At5g25630

SGN-M8842
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303207 (SGN)
120288 (CGN)
---
Capsicum annuumSingleSGN-U201026---
Lycopersicon CombinedSingleSGN-U223916---
Solanum tuberosumSingleSGN-U251940---
ArabidopsisSingleAt5g25630 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109245)
Chromosome
8
Position
29.72 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tobacco N. acuminata   
Map version
89 (location: 46531)
Chromosome
8
Position
70.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41526)
Chromosome
1
Position
170.00 cM
Confidence
I
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43502
Forward primer (5'-3')
TTTCAATTCACTGATCAAAGGTTTCC
Accessions and product sizes
Approximate temperature
44°C
Reverse primer (5'-3')
CCATCCTAAGACCTAAAGAAGTATATAGA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38827)
Chromosome
8
Position
41.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39948
Forward primer (5'-3')
TTTCAATTCACTGATCAAAGGTTTCC
Accessions and product sizes
Solanum lycopersicum TA209
300
Solanum pennellii TA56
550
Approximate temperature
55°C
Reverse primer (5'-3')
ACCTCCCTGCACTTAACCATATATCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
300
Solanum pennellii TA56
550
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27303)
Chromosome
5
Position
8.95 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11815
Forward primer (5'-3')
TTTCAATTCACTGATCAAAGGTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCCTGCACTTAACCATATATCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Approximate temperature
53°C
  
PCR data   Exp. ID 11816
Forward primer (5'-3')
TTTCAATTCACTGATCAAAGGTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCCTGCACTTAACCATATATCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1650
Approximate temperature
53°C
  
PCR data   Exp. ID 11817
Forward primer (5'-3')
TTTCAATTCACTGATCAAAGGTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCCTGCACTTAACCATATATCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1650
Approximate temperature
53°C
  
PCR data   Exp. ID 13808
Forward primer (5'-3')
TTTCAATTCACTGATCAAAGGTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCCTGCACTTAACCATATATCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13809
Forward primer (5'-3')
TTTCAATTCACTGATCAAAGGTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCCTGCACTTAACCATATATCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13810
Forward primer (5'-3')
TTTCAATTCACTGATCAAAGGTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCCTGCACTTAACCATATATCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1900
Approximate temperature
55°C
  
PCR data   Exp. ID 13811
Forward primer (5'-3')
TTTCAATTCACTGATCAAAGGTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCCTGCACTTAACCATATATCC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1900
Approximate temperature
55°C
  
PCR data   Exp. ID 32657
Forward primer (5'-3')
TTTCAATTCACTGATCAAAGGTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCCTGCACTTAACCATATATCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 33241
Forward primer (5'-3')
TTTCAATTCACTGATCAAAGGTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCCTGCACTTAACCATATATCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 33242
Forward primer (5'-3')
TTTCAATTCACTGATCAAAGGTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCCTGCACTTAACCATATATCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 33243
Forward primer (5'-3')
TTTCAATTCACTGATCAAAGGTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCCTGCACTTAACCATATATCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 33244
Forward primer (5'-3')
TTTCAATTCACTGATCAAAGGTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCCTGCACTTAACCATATATCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1900
Approximate temperature
55°C
  
PCR data   Exp. ID 11818
Forward primer (5'-3')
TTTCAATTCACTGATCAAAGGTTTCC
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 1650
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCTCCCTGCACTTAACCATATATCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
All possible enzymes for lycopersicum and pimpinellifolium: HinfI
  
Accessions and product sizes
Solanum lycopersicum LA925: 1650
Solanum pennellii LA716: 1000
Approximate temperature
53°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g25630  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8842 marker 8842
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)