Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker C2_At5g25940

SGN-M8845
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304156 (SGN)
119954 (CGN)
---
Lycopersicon CombinedSingleSGN-U228494---
Solanum tuberosumMultipleSGN-U248583---
ArabidopsisSingleAt5g25940 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38830)
Chromosome
8
Position
23.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39951
Forward primer (5'-3')
AGCAGCCGCAGTTGCTTGTGTTG
Accessions and product sizes
Solanum lycopersicum TA209
150
Solanum pennellii TA56
150
Approximate temperature
55°C
Reverse primer (5'-3')
ATTTGCCTTTGCCCAAGGAATTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
150
Solanum pennellii TA56
100
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27307)
Chromosome
5
Position
9.05 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11827
Forward primer (5'-3')
AGCAGCCGCAGTTGCTTGTGTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTTGCCTTTGCCCAAGGAATTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1700
Approximate temperature
55°C
  
PCR data   Exp. ID 11828
Forward primer (5'-3')
AGCAGCCGCAGTTGCTTGTGTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTTGCCTTTGCCCAAGGAATTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1700
Approximate temperature
55°C
  
PCR data   Exp. ID 11829
Forward primer (5'-3')
AGCAGCCGCAGTTGCTTGTGTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTTGCCTTTGCCCAAGGAATTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1700
Approximate temperature
55°C
  
PCR data   Exp. ID 32581
Forward primer (5'-3')
AGCAGCCGCAGTTGCTTGTGTTG
Digested band sizes (using HaeIII)
Solanum pennellii LA716: 1650
Solanum lycopersicum LA925: 1500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTTGCCTTTGCCCAAGGAATTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: HaeIII
  
Accessions and product sizes
Solanum lycopersicum LA925: 1700
Solanum pennellii LA716: 1700
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At5g25940  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8845 marker 8845
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)