SGN Marker C2_At5g27450

SGN-M8858
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309532 (SGN)
126976 (CGN)
---
Lycopersicon CombinedMultipleSGN-U217259---
Solanum tuberosumSingleSGN-U248366---
ArabidopsisSingleAt5g27450 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 27320)
Chromosome
5
Position
9.69 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41775
Forward primer (5'-3')
AATAATTCATGGGAAGCCATCTGG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TCAGAGACGCTAGCCACCAATGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 11841
Forward primer (5'-3')
AATAATTCATGGGAAGCCATCTGG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCAGAGACGCTAGCCACCAATGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1850
Approximate temperature
Unknown
  
PCR data   Exp. ID 11842
Forward primer (5'-3')
AATAATTCATGGGAAGCCATCTGG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCAGAGACGCTAGCCACCAATGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1850
Approximate temperature
Unknown
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g27450  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8858 marker 8858
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)