Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker SSR214

SGN-M887

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 57.895 High: 45
Repeat motif: CTT   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: AAATTCCCAACACTTGCCAC
Reverse primer: CCCACCACTATCCAAACCC
Predicted size: 221
Derivations 
This marker was derived from EST read SGN-E25162
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39189)
Chromosome
4
Position
95.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14107
Forward primer (5'-3')
AAATTCCCAACACTTGCCAC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CCCACCACTATCCAAACCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 221+224
Solanum lycopersicum LA925: 221+222
Approximate temperature
50°C
  
Genomic location of SSR214  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D887 marker 887
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)