SGN Marker C2_At5g36210

SGN-M8884
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300955 (SGN)
121234 (CGN)
---
Lycopersicon CombinedMultipleSGN-U221344---
Solanum tuberosumSingleSGN-U254557---
ArabidopsisSingleAt5g36210 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49296)
Chromosome
10
Position
46.40 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47237)
Chromosome
10
Position
31.90 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46763)
Chromosome
10
Position
46.20 cM
Confidence
F(LOD3)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38845)
Chromosome
10
Position
33.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41788
Forward primer (5'-3')
TCAAATGTTGTAGATTTCAGTATCATGTGG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TAGTCCAATATTGGATGCTAAGATTTAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27348)
Chromosome
5
Position
14.27 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g36210  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8884 marker 8884
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)