SGN Marker C2_At5g36290

SGN-M8885
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310521 (SGN)
125909 (CGN)
---
Lycopersicon CombinedSingleSGN-U217792---
Solanum tuberosumMultipleSGN-U245520---
ArabidopsisSingleAt5g36290 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 27349)
Chromosome
5
Position
14.32 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41789
Forward primer (5'-3')
TGGTGCGCTCAGTGCCTTGTTTG
Accessions and product sizes
Solanum pennellii TA56
450
Solanum lycopersicum TA209
450
Approximate temperature
55°C
Reverse primer (5'-3')
TAGCGGCACTATTTGTATGCTTCC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
330
Solanum lycopersicum TA209
450
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 11854
Forward primer (5'-3')
TGGTGCGCTCAGTGCCTTGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGCGGCACTATTTGTATGCTTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11855
Forward primer (5'-3')
TGGTGCGCTCAGTGCCTTGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGCGGCACTATTTGTATGCTTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11856
Forward primer (5'-3')
TGGTGCGCTCAGTGCCTTGTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGCGGCACTATTTGTATGCTTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g36290  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8885 marker 8885
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)